DNA primer design for sex identification of Sumatran tiger body samples
Main Article Content
Abstract
Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported.
Article Details
Issue
Section

This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.
References
Ahmad A, Rahat MA, Wahab A, Subhanuddin, Shah M, Rasool A, Israr M. 2021. PCR-based sex determination in Cattle using gene specific markers. Pak J Biochem Biotechnol 2 (2): 134-139. DOI: 10.52700/pjbb.v2i2.93.
Ashrifurrahman, Fadhlullah A, Ericca C, Simamora S, Novarino W, Roesma DI. 2019. Characteristic of CO1 gene in “Bonita”, one of the female tiger Panthera tigris sumatrae in East Sumatra. World J Adv Res Rev 4 (2): 043-048. DOI: 10.30574/wjarr.2019.4.2.0055.
Ashrifurrahman, Simamora S, Ritonga R, Novarino W, Tjong DH, Rizaldi, Syaifullah, Roesma DI. 2022. Sumatran tiger identification and phylogenetic analysis basedon the CO1 gene: Molecular forensic application. Biodiversitas 23 (4): 1788-1794. DOI: 10.13057/biodiv/d230410.
Asrori I, Tjong DH, Roesma DI, Novarino W, Syaifullah, Mansyurdin. 2022. DNA Sexing Sumatran tiger (Panthera tigris sumatrae) based on amelogenin gene. World J Adv Res Rev 14 (3): 190-194. DOI: 10.52700/pjbb.v2i2.93.
Assal N, Lin M. 2021. PCR procedures to amplify GC-rich DNA sequences of Mycobacterium bovis. J Microbiol Methods 181: 106121. DOI: 10.1016/j.mimet.2020.106121.
Banaganapalli B. 2019. In silico PCR. In: Shaik N, Hakeem K, Banaganapalli B, Elango R (eds.). Essentials of Bioinformatics, Volume I. Springer, Cham. DOI: 10.1007/978-3-030-02634-9_16.
Brodin J, Krishnamoorthy M, Athreya G, Fischer W, Hraber P, Gleasner C, Green L, Korber B, Leitner T. 2013. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets. BMC Bioinform 14: 255-283. DOI: 10.1186/1471-2105-14-255.
Chowdhury RM, Singhvi A, Bagul N, Bhatia S, Singh G, Goswami S. 2018. Sex determination by amplification of amelogenin gene from dental pulp tissue by Polymerase Chain Reaction. Indian J Dent Res 29: 470-476. DOI: 10.4103/ijdr.IJDR_274_17.
Chuang LY, Cheng YH, Yang CH. 2013. Spesific primer design for the Polymerase Chain Reaction. Biotechhnol Lett 35 (10): 1541-1549. DOI: 10.1007/s10529-013-1249-8.
Colorado FAG, Ne Matta C, Sánchez A. 2012. Sex-determination systems and their evolution: Mammals. Acta Biol Colomb 17 (1): 3 - 18.
Das PP, Krishnan G, Doley J, Bhattacharya D, Deb SM, Chakravarty P, Das PJ. 2019. Establishing gene Amelogenin as sex-specific marker in yak by genomic approach. J Genet 98: 7. DOI: 10.1007/s12041-019-1061-x
Dash HR, Rawat N, Das S. 2020. Alternatives to amelogenin markers for sex determination in humans and their forensic relevance. Mol Biol Rep 47: 2347-2360. DOI: 10.1007/s11033-020-05268-y.
Dutta P, Bhosale S, Singh R, Gubrellay P, Patil J, Sehdev B, Bhagat S, Bansal T. 2017. Amelogenin gene - The pioneer in gender determination from forensic dental samples. J Clin Diagn Res 11 (2): ZC56-ZC59. DOI: 10.7860/JCDR/2017/22183.9407.
Erwanto Y, Sugiyono A, Rohman, Abidin MZ, Ariyani D. 2012. Identifikasi daging babi menggunakan metode Pcr-Rflp gen Cytochrome B dan PCR primer spesifik gen Amelogenin. Agritech 32 (4): 370-377. DOI: 10.22146/agritech.9579.
Fábián R, Kovács A, Stéger V, Frank K, Egerszegi I, Oláh J, Bodó S. 2017. X and Y chromosome specific variants of the amelogenin gene allow non-invasive sex diagnosis for the detection of pseudohermaphrodite goats. Acta Vet Hung 65 (4): 500-504. DOI: 10.1556/004.2017.047.
Farahvash T, Torshizi RV, Masoudi AA, Rezaei HR, Tavallaei M. 2016. AMELX and AMELY Structure and application for sex determination of Iranian maral deer (Cervus elaphus maral). Iran J Appl Anim Sci 6 (4): 963-968.
Garafutdinov RR, Aizilya A, Galimova, Assol R, Sakhabutdinova. 2020. The influence of quality of primers on the formation of primer dimers in PCR. Nucleos Nucleot Nucl Acids 39 (9): 1251-1269. DOI: 10.1080/15257770.2020.1803354.
Gokulakrishnan P, Kumar R, Sharma B, Mendiratta S, Sharm D, Malav O. 2012. Sex determination of cattle meat by polymerase chain reaction amplification of the Amelogenin (AMELX/AMELY) gene. Vet World 5: 526-529. DOI: 10.5455/vetworld.2012.526-529.
Goodrich J, Lynam A, Miquelle D, Wibisono H, Kawanishi K, Pattanavibool A, Htun S, Tempa T, Karki J, Jhala Y, Karanth U. 2015. Panthera tigris. The IUCN Red List of Threatened Species e.T15955A50659951. https://www.iucnredlist.org
Hisao Y, Ayana I. 2016. Human Blastocystis subtyping with subtype-specific primers developed from unique sequences of the SSU rRNAgene. Parasitol Intl 65 (6 Pt B): 785-791. DOI: 10.1016/j.parint.2016.03.00.
Hofreiter M, Jaenicke V, Serre D, von Haeseler A, Pääbo S. 2001. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucleic Acids Res 29 (23): 4793-9. DOI: 10.1093/nar/29.23.4793.
Huber P, Cornejo FM, Ferrera I, Sánchez P, Logares R, Metz S, Balagué V, Acinas SG, Gasol JM, Unrein F. 2019. Primer design for an accurate view of picocyanobacterial community structure by using high-throughput sequencing. Microbial Ecol 85 (7): E02659-18. DOI: 10.1128/AEM.02659-18.
Jansson L, Hedmana J. 2019. Challenging the proposed causes of the PCR plateau phase. Biomol Detect Quantif 17: 2214-7535. DOI: 10.1016/j.bdq.2019.100082.
Joshi DB, De R, Goyal SP. 2019. Utility and applicability of a universal set of primers in identifying the sex of south and Southeast Asian Mammals. Zool Stud 58: e19. DOI: 10.6620/ZS.2019.58-19.
Kamarcharya D, Sherchan AM, Dulal S, Manandhar P, Manandhar S, Joshi J, Bhattarai S, Bhatta TR, Awasthi N, Sharma AN, Bista M, Silwal NR, Pokharel P, Lamichhane RR, Sharma N, Llewellyn B, Wultsch C, Kelly MJ, Gour D, Waits L, Hero JM, Hughes J. 2018. Species, sex and geo-location identification of seized tiger (Panthera tigris tigris) parts in Nepal—A molecular forensic approach. PLoS ONE: 1-16. DOI: 10.1371/journal.pone.0201639.
Kawasaki K, Mikami M, Goto M. 2020. The evolution of unusually small Amelogenin genes in cetaceans; pseudogenization, X-Y gene conversion, and feeding strategy. J Mol Evol 88: 122-135. DOI: 10.1007/s00239-019-09917-0.
Kumar A, Kaur J, Kumar A, Kaur J. 2014. Primer based approach for PCR amplification of high GC content gene: Mycobacterium gene as a model. Mol Biol Intl 2014: 937308. DOI: 10.1155/2014/937308.
Lohay GG. 2020. An accurate molecular method to sex savannah elephants using PCR amplification of Amelogenin gene. Pachyderm 61: 90-96. DOI: 10.1101/856419.
Lucas CG, Spate AM, Samuel MS. 2022. A novel swine sex-linked marker and its application across different mammalian species. Transgenic Res 29: 395-407. DOI: 10.1007/s11248-020-00204-z.
Meagher RJ, Priye A, Light YK, Huang C, Wang E. 2018. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA. Royal Soc Chem 143: 1924-1933. DOI: 10.1039/c7an01897e.
Mona S. 2021. Basic concepts of primer designing: A minireview. Intl J Latest Trends Eng Technol 17 (4): 010-012. DOI: 10.21172/1.174.03.
Mubarak SM, Al-Koofee DAF, Radhi OA, Ismael JM, Al-Zubaidi ZF. 2020. An optimization and common troubleshooting solving in Polymerase Chain Reaction technique. Sys Rev Pharm 11 (2): 427 436. DOI: 10.5530/srp.2020.2.63.
Pandhee S, Phavaphutanon J, Sirinarumitr K, Laopiem S, Sirinarumitr T. 2016. Evaluation of Amelogenin and Zinc-finger Loci for sex identification in captive felids. Thai J Vet Med l46 (1): 41-47.
Pilgrim KL, Mckelvey KS, Riddle AE, Schwartz MK. 2005. Felid sex identification based on noninvasive genetic samples. Mol Ecol Notes 5 (1): 60-61. DOI: 10.1111/j.1471-8286.2004.00831.x.
Schweitzer MH, Avci R, Collier T, Goodwin MB. 2008. Microscopic, chemical and molecular methods for examining fossil preservation Méthodes d’études microscopiques, chimiques et moléculaires pour l’examen de la conservation des fossiles. Comptes Rendus Palevol 7: 159-184. DOI: 10.1016/j.crpv.2008.02.005.
Seidensticker J, Christie S, Jackson P. 1999. Introducing the tiger. In: Seidensticker J, Christie S, Jackson P (eds). Riding The Tiger: Tiger Conservation in Human Dominated Landscape. Univ Press Cambridge, UK.
Victoriano CM, Megan EP, Nicole AM, Seegmiller A, Simmons S, Schmitz JE, Haselton FR, Adams NM. 2022. Direct PCR with the CDC 2019 SARS CoV 2 assay: Optimization for limited resource settings. Sci Rep 12: 11756. DOI: 10.1038/s41598-022-15356-7.
Wang C. 2016. Primer Design. Centre for Medical Parasitology University of Copenhagen. Health Science, Denmark.
Wu JS, Lee C, Wu CC, Shiue YL. 2004. Primer design using genetic algorithm. Bioinformatics 20 (11): 1710-1. DOI: 10.1093/bioinformatics/bth147.
Xue HR, Yamaguchi N, Driscoll CA, Han Y, Bar-Gal GK, Zhuang Y, Mazak JH, Macdonald DW, O’Brien SJ, Luo S-J. 2015. Genetic ancestry of the extinct Javan and Bali Tigers. J Hered 2015: 247-257. DOI: 10.1093/jhered/esv002.
Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. 2012. Primer-BLAST: A tool to design target-specific primers for Polymerase Chain Reaction. BMC Bioinform 13: 134-144. DOI: 10.1186/1471-2105-13-134.